CD1D Recombinant Protein

Catalogue Number: NCP0188-500, NCP0188-1000

Sizes: 500ug, 1mg

Swiss-Prot: P15813

Host: E.coli

Tag: His-tag

AA Sequence: GAAGTGCCGCAGCGTCTGTTCCCGCTGCGCTGCCTGCAGATTAGCAGCTTCGCCAATAGCAGCTGGACCCGTACCGATGGTCTGGCCTGGCTGGGTGAACTGCAGACCCATAGTTGGAGTAATGATAGTGATACCGTGCGCAGTCTGAAACCGTGGAGCCAGGGCACCTTCAGTGATCAGCAGTGGGAAACCTTACAGCATATCTTCCGTGTGTATCGTAGCAGCTTCACCCGTGATGTTAAAGAATTCGCAAAAATGCTGCGTCTGAGCTATCCGCTGGAACTGCAGGTTAGCGCAGGTTGCGAAGTTCATCCGGGCAATGCAAGCAATAACTTCTTCCATGTGGCATTCCAGGGCAAAGATATTCTGAGCTTCCAGGGCACCAGCTGGGAACCGACCCAGGAAGCACCGCTGTGGGTTAATCTGGCAATTCAGGTTCTGAATCAGGATAAATGGACCCGCGAAACCGTGCAGTGGCTGCTGAATGGTACCTGCCCGCAGTTCGTGAGCGGCCTGCTGGAAAGTGGCAAAAGTGAACTGAAAAAACAGGTTAAACCGAAAGCCTGGCTGAGCCGCGGTCCGAGTCCGGGTCCTGGTCGTCTGCTGCTGGTGTGTCATGTGAGTGGCTTCTATCCGAAACCGGTGTGGGTTAAATGGATGCGTGGTGAACAGGAACAGCAGGGCACCCAGCCGGGTGATATTCTGCCGAATGCAGATGAAACCTGGTATCTGCGTGCAACCCTGGATGTTGTTGCAGGCGAAGCCGCAGGTCTGAGCTGCCGTGTTAAACATAGTAGCCTGGAAGGTCAGGATATTGTTCTGTATTGGGGTGGCAGTTATACCAGT

Restriction Sites: NdeI-XhoI

Background: The CD1 multigene family encodes five forms of the CD1 T cell surface glycoprotein in human, designated CD1A, 1B, 1C, 1D and 1E. CD1, a type 1 membrane protein, has structural similarity to the MHC class I antigen and has been shown to present lipid antigens for recognition by T lymphocytes. CD1 antigens are associated with β-2-Microglobulin and expressed on cortical thymocytes, Langerhans cells, a B cell subset and some dendritic cells. Adaptor protein complexes and CD1-associated chaperones control CD1 trafficking and the development and activation of CD1-restricted T cells. CD1D is present on human intestinal epithelial cells (IEC) and exists as a β-2-Microglobulinindependent nonglycosylated form or a β-2-Microglobulin-dependent glycosylated form. The human CD1D gene maps to chromosome 1q23.1 and encodes a 335 amino acid protein that influences normal T cell maturation.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~31kDa

Notes: For research use only, not for use in diagnostic procedure.